Journal: Aging (Albany NY)

Article Title: Circular RNA RHOT1 promotes progression and inhibits ferroptosis via mir-106a-5p/STAT3 axis in breast cancer

doi: 10.18632/aging.202608

Figure Lengend Snippet: MiR-106a-5p induces ferroptosis by targeting STAT3 in breast cancer cells. ( A ) The interaction of miR-106a-5p and STAT3 3’ UTR was identified by bioinformatic analysis using Targetscan ( http://www.targetscan.org/vert_72/ ). ( B – D ) The MDA-MB-231 and T47D cells were treated with the miR-106a-5p mimic or control mimic. ( B ) The luciferase activities of wild type STAT3 (STAT3 WT) and STAT3 with the miR-106a-5p-binding site mutant (STAT3 MUT) were determined by luciferase reporter gene assays in the cell. ( C ) The mRNA expression of STAT3 was analyzed by qPCR in the cells. ( D ) The protein expression of STAT3 and β-actin was tested by Western blot analysis in the cells. ( E ) The MDA-MB-231 and T47D cells were treated control shRNA, circRHOT1 shRNA, or co-treated with circRHOT1 shRNA and miR-106a-5p inhibitor. The protein expression of STAT3 and β-actin was assessed by Western blot analysis in the cells. ( E , F ) The MDA-MB-231 and T47D cells were treated with 5 mmol/L erastin, co-treated with 5 mmol/L erastin and miR-106a-5p mimic, or o-treated with 5 mmol/L erastin, miR-106a-5p mimic, and pcDNA.1-STAT3. The cell growth was analyzed by MTT assays. ( G – I ) The MDA-MB-231 and T47D cells were treated control shRNA, miR-106a-5p mimic, or co-treated with miR-106a-5p mimic and pcDNA.1-STAT3. ( G ) The levels of iron were analyzed by Iron Assay Kit. ( H ) The levels of ROS were measure by flow cytometry analysis in the cells. ( I ) The expression of GPX4, SLC7A11, and β-actin was measured by Western blot analysis in the cells. Data are presented as mean ± SD. Statistic significant differences were indicated: ** P < 0.01.

Article Snippet: The lentiviral plasmids carrying circRHOT1 shRNA, the corresponding control shRNA, the pcDNA3.1-circRHOT1 overexpression vector, the pcDNA3.1-STAT3 overexpression vector, miR-106a-5p mimic, miR-106a-5p inhibitor, and corresponding control were synthesized and purchased (GenePharma, China) (GenScript, China).

Techniques: Luciferase, Binding Assay, Mutagenesis, Expressing, Western Blot, shRNA, Iron Assay, Flow Cytometry

Journal: Aging (Albany NY)

Article Title: Circular RNA RHOT1 promotes progression and inhibits ferroptosis via mir-106a-5p/STAT3 axis in breast cancer

doi: 10.18632/aging.202608

Figure Lengend Snippet: CircRHOT1 contributes to breast cancer progression by miR-106a-5p/STAT3 axis. ( A – D ) The MDA-MB-231 and T47D cells were treated control shRNA, circRHOT1 shRNA, or co-treated with circRHOT1 shRNA and miR-106a-5p inhibitor or pcDNA.1-STAT3. ( A , B ) The cell viability was measured by MTT assays in the cells. ( C , D ) The cell apoptosis was measure by flow cytometry analysis in the cells. Data are presented as mean ± SD. Statistic significant differences were indicated: ** P < 0.01.

Article Snippet: The lentiviral plasmids carrying circRHOT1 shRNA, the corresponding control shRNA, the pcDNA3.1-circRHOT1 overexpression vector, the pcDNA3.1-STAT3 overexpression vector, miR-106a-5p mimic, miR-106a-5p inhibitor, and corresponding control were synthesized and purchased (GenePharma, China) (GenScript, China).

Techniques: shRNA, Flow Cytometry

Journal: Aging (Albany NY)

Article Title: Circular RNA RHOT1 promotes progression and inhibits ferroptosis via mir-106a-5p/STAT3 axis in breast cancer

doi: 10.18632/aging.202608

Figure Lengend Snippet: CircRHOT1 promotes the tumor growth of breast cancer in vivo . ( A – E ) The effect of circRHOT1 on tumor growth of breast cancer cells in vivo was analyzed by nude mice tumorigenicity assay by injected with the MDA-MB-231 cells treated with control shRNA or circRHOT1 shRNA. ( A ) Representative images of dissected tumors from nude mice were presented. ( B ) The average tumor volume was calculated and shown. ( C ) The average tumor weight was calculated and shown. ( D ) The expression levels of miR-106a-5p were measured by qPCR in the tumor tissues of the mice. ( E ) The protein expression of STAT3 and β-actin was assessed by Western blot analysis in the tumor tissues of the mice. N = 5. Data are presented as mean ± SD. Statistic significant differences were indicated: ** P < 0.01.

Article Snippet: The lentiviral plasmids carrying circRHOT1 shRNA, the corresponding control shRNA, the pcDNA3.1-circRHOT1 overexpression vector, the pcDNA3.1-STAT3 overexpression vector, miR-106a-5p mimic, miR-106a-5p inhibitor, and corresponding control were synthesized and purchased (GenePharma, China) (GenScript, China).

Techniques: In Vivo, Tumorigenicity Assay, Injection, shRNA, Expressing, Western Blot

Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: (A) Micrograph of a neuron expressing ASAP1. Scale bar, 10 μm.

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Expressing

Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Mutagenesis, Immunoprecipitation, Isolation, Protein Extraction, Lysis, Labeling, Construct, Plasmid Preparation, shRNA, Software

Journal: Experimental and Therapeutic Medicine

Article Title: MicroRNA-19a-3p inhibits the cellular proliferation and invasion of non-small cell lung cancer by downregulating UBAP2L

doi: 10.3892/etm.2020.8926

Figure Lengend Snippet: UBAP2L is a direct target of miR-19a-3p. (A) Schematic representation of the miR-19a-3p target sequence with the 3'-UTR of UBAP2L. The mutant 3'-UTR of UBAP2L is also presented. (B) A dual-luciferase reporter assay was performed using A549 and H1299 cells. (C) The expression of UBAP2L mRNA in A549 and H1299 cells transfected with miR-19a-3p mimics or miR-NC was detected using a reverse transcription-quantitative polymerase chain reaction assay. (D) UBAP2L protein levels were detected using Western blotting. Data are presented as the mean ± standard deviation from triplicate experiments. **P<0.01 and ***P<0.001 vs. miR-NC. UBAP2L, ubiquitin associated protein 2 like; UTR, untranslated region; miR, miRNA; NC, negative control; WT, wild type; MUT, mutant.

Article Snippet: All cell lines were maintained in 90% media supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) in a 5% CO 2 humidified environment at 37 ̊C. miR-19a-3p mimics, small interfering (si)RNA for UBAP2L (siUBAP2L, cat. no. 3624), the UBAP2L overexpression plasmid (pcDNA3.1-UBAP2L; cat. no. 1302) and their corresponding negative controls (NC; cat. no. 4126; miR-NC; cat. no. 3106, siNC; cat. no. 2036 and pcDNA3.1; cat. no. 1987, respectively) were purchased from Shanghai GenePharma Co., Ltd., (Shanghai, China).

Techniques: Sequencing, Mutagenesis, Luciferase, Reporter Assay, Expressing, Transfection, Reverse Transcription, Real-time Polymerase Chain Reaction, Western Blot, Standard Deviation, Ubiquitin Proteomics, Negative Control

Journal: Experimental and Therapeutic Medicine

Article Title: MicroRNA-19a-3p inhibits the cellular proliferation and invasion of non-small cell lung cancer by downregulating UBAP2L

doi: 10.3892/etm.2020.8926

Figure Lengend Snippet: UBAP2L knockdown suppressed NSCLC cell proliferation, migration and invasion. (A) Pearson's correlation analysis was used to determine the association between miR-19a-3p and UBAP2L mRNA expression levels in NSCLC tissues. A549 cells were transfected with siUBAP2L or siNC for 48 h and (B) UBAP2L protein expression was determined by western blot analysis. (C) A549 cell proliferation was determined using an MTT assay. (D) Wound healing and (E) Transwell Matrigel invasion assays were performed to assess A549 cell migration and invasion. Data are presented as the mean ± standard deviation from triplicate experiments. **P<0.01 and ***P<0.001 vs. siNC. UBAP2L, ubiquitin associated protein 2 like; NSCLC, non-small cell lung cancer; miR, miRNA; si, small interfering; NC, negative control; OD, optical density.

Article Snippet: All cell lines were maintained in 90% media supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) in a 5% CO 2 humidified environment at 37 ̊C. miR-19a-3p mimics, small interfering (si)RNA for UBAP2L (siUBAP2L, cat. no. 3624), the UBAP2L overexpression plasmid (pcDNA3.1-UBAP2L; cat. no. 1302) and their corresponding negative controls (NC; cat. no. 4126; miR-NC; cat. no. 3106, siNC; cat. no. 2036 and pcDNA3.1; cat. no. 1987, respectively) were purchased from Shanghai GenePharma Co., Ltd., (Shanghai, China).

Techniques: Knockdown, Migration, Expressing, Transfection, Western Blot, MTT Assay, Standard Deviation, Ubiquitin Proteomics, Negative Control

Journal: Experimental and Therapeutic Medicine

Article Title: MicroRNA-19a-3p inhibits the cellular proliferation and invasion of non-small cell lung cancer by downregulating UBAP2L

doi: 10.3892/etm.2020.8926

Figure Lengend Snippet: UBAP2L upregulation partially reverses the effects of miR-19a-3p on NSCLC cell proliferation, migration and invasion. A549 cells were transfected with pcDNA3.1 or pcDNA3.1 + UBAP2L expression plasmids, which in turn were co-transfected with the miR-19a-3p expression plasmid. (A) Western blotting was performed to assess UBAP2L protein expression. GAPDH was used as a loading control. (B) MTT, (C) wound healing and (D) Transwell Matrigel invasion assays were performed to determine A549 cell proliferation, migration and invasion. Data are presented as the mean ± standard deviation from triplicate experiments. *P<0.05 and ***P<0.001 vs. miR-19a-3p mimics + pcDNA3.1. UBAP2L, ubiquitin associated protein 2 like; miR, miRNA; NSCLC, non-small cell lung cancer; optical density.

Article Snippet: All cell lines were maintained in 90% media supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) in a 5% CO 2 humidified environment at 37 ̊C. miR-19a-3p mimics, small interfering (si)RNA for UBAP2L (siUBAP2L, cat. no. 3624), the UBAP2L overexpression plasmid (pcDNA3.1-UBAP2L; cat. no. 1302) and their corresponding negative controls (NC; cat. no. 4126; miR-NC; cat. no. 3106, siNC; cat. no. 2036 and pcDNA3.1; cat. no. 1987, respectively) were purchased from Shanghai GenePharma Co., Ltd., (Shanghai, China).

Techniques: Migration, Transfection, Expressing, Plasmid Preparation, Western Blot, Control, Standard Deviation, Ubiquitin Proteomics